Sale!

Assignment #5 – Automatic identification of primers

Original price was: $35.00.Current price is: $30.00.

Category:
Rate this product

Assignment #5 – Automatic identification of primers
In this assignment your script will take in a DNA sequence file for the C. elegans genome, and a
chromosome and position you want amplified.
The idea is that the user wants to genotype a SNP at a particular position. To do this they will need to
amplify a sequence of DNA around 600-800 bp long. It is also important that the beginning and end of
the PCR product is at least 100 bp away. A visual schematic is included below. The first primer should
be chosen between 0-400. The second primer should be chosen between 600-1000. The total product
size should be 600-800 bp long.
You should use primer3 to choose the primers and report back the best choice. Some example output
is included below. I have uploaded the fasta_file for you to use as well.
[pmcgrath7@bioebb301301:~/Dropbox/NewGeneralWork/Teaching/BIOL48038803/Assignment
s]$python3 Assignment7_Solution.py -h
usage: Assignment7_Solution.py [-h] fasta_file chromosome position
This program runs primer3 to identify the best two primers to amplify a given
sequence
positional arguments:
fasta_file Enter a genome file containing DNA sequence
chromosome Enter the chromosome you want amplified
position Enter the position you want amplified
optional arguments:
-h, –help show this help message and exit
$ python3 Assignment7_Solution.py c_elegans.WS220.genomic.fa CHROMOSOME_I 4564564
ttggcagttgggaccgttta
catcgagcagtgcaggaaga
$ python3 Assignment7_Solution.py c_elegans.WS220.genomic.fa CHROMOSOME_V 4564564
tgcccaggaaaatgtgacgt
catcccccatgtcgattcga
$ python3 Assignment7_Solution.py c_elegans.WS220.genomic.fa CHROMOSOME_V 45645
ggagccaaagataacgccct
cggtaaccggcaattttgga
$ python3 Assignment7_Solution.py c_elegans.WS220.genomic.fa CHROMOSOME_III
456452
gtcctctaggagccgaggaa
ttggaaggagtggggaaacg
$ python3 Assignment7_Solution.py c_elegans.WS220.genomic.fa CHROMOSOME_IV 456452
gacaggccgaggtatgtacg
ctgcaagttctcgggcagta
0 400 600 1000

Reviews

There are no reviews yet.

Be the first to review “Assignment #5 – Automatic identification of primers”

Your email address will not be published. Required fields are marked *

Scroll to Top